Zaloguj się lub zarejestruj.

Zaloguj się podając nazwę użytkownika, hasło i długość sesji
Szukanie zaawansowane  

Aktualności:

SMF - Just Installed!

Strony: 1 2 [3] 4 5 ... 28

Autor Wątek: Lateńskie L1029  (Przeczytany 28032 razy)

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #30 dnia: Listopad 04, 2021, 07:30:07 am »

Jeżeli dobrze pamiętam, to gdzieś chyba podsumowywałem te próbki. Tak na oko, to przedśredniowieczne próbki środkowoeuropejskie z pokaźnym udziałem dryfu bałtosłowiańskiego stanowią zdecydowaną większość. Natomiast samą ich pozycją na PCA z G25 to bym się zbytnio nie sugerował.
Zapisane

Radek

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #31 dnia: Listopad 04, 2021, 07:34:05 am »

Próbka jest o kilkaset lat zbyt wczesna na tę mutację.

YFull wedlug wielu (w tym np. Michala) zaniza daty o co najmniej 10-20%.

Arza napisal:
"Hard to say whether this read is correct or not, but there's nothing suspicious in the bam file:

chry 23495214 YP5269 R1a1a1b1a1a1c1a3a~ G->A G A 1 100 A D

23207:13567:13556 0 Y 23495182 37 40M * 0 0 CAATGGTCCAGAGCTTGTAACCCAGCACTTTCAGGTGTAA EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE X0:i:1 X1:i:0 MD:Z:32G7 XD:Z:GACTGTA_GCTACAT_40 RG:Z:Hupyrian_1240k_plus_half_S13780.Y1.E1.L1_20181105_HN2JLBGX7_1 XG:i:0 NM:i:1 XM:i:1 XO:i:0 XT:A:U

Mapping and base quality are both high."
Zapisane

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #32 dnia: Listopad 04, 2021, 07:37:13 am »

Faktycznie podsumowywałem tego typu próbki z epoki żelaza w tym wątku:

https://slawomirambroziak.pl/forum/index.php?topic=5296.0
Zapisane

S_u_P_K

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #33 dnia: Listopad 04, 2021, 07:40:30 am »

Ta linia ma datę 1700 BP (100 AD - przełom I i II w. n.e. - u Arzy to szacowany wiek mutacji po jakiejś kalibracji daty). Po doliczeniu 20% uzyskuje się najwyżej (licząc od r. 1950) początek I w. p.n.e. Okres lateński jest bodajże wcześniejszy (zwłaszcza popularność inhumacji w Czechach).

Deaminacja to rzeczywista zmiana nukleotydu po ustaniu działania mechanizmów naprawczych, więc base quality może być wysokie, a odczyt w porównaniu z żywym Y-DNA mimo to przekłamany. Arza powinien mieć świadomość, że większość czytelników jego blogu nie rozumie technikaliów podanych w taki sposób.
« Ostatnia zmiana: Listopad 04, 2021, 07:44:43 am wysłana przez S_u_P_K »
Zapisane

Radek

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #34 dnia: Listopad 04, 2021, 07:43:53 am »

Jeżeli dobrze pamiętam, to gdzieś chyba podsumowywałem te próbki. Tak na oko, to przedśredniowieczne próbki środkowoeuropejskie z pokaźnym udziałem dryfu bałtosłowiańskiego stanowią zdecydowaną większość. Natomiast samą ich pozycją na PCA z G25 to bym się zbytnio nie sugerował.

Jezeli zadna probka sprzed VI w. nie bedzie nam podobnie bliska autosomalnie jak np. AV1/2, to jednak doszlo do jakiegos zdarzenia, ktore zmienilo dosyc istotnie profil autosomalny przodkow Slowian.

Poza tym czekam na udowodnienie tezy przez Figlerowicza oraz Benesza, ze male grupy wojownikow slowianskich w V/VI w. wybily innych mezczyzn, poslubily lokalne kobiety i zdobyly dominujaca role na szerszym obszarze, a ludnosc lokalna stopniowo przejela ich slowianski jezyk oraz zwyczaje. Ci wojownicy slowianscy musieli niezle namieszac w liniach Y-DNA.
Zapisane

S_u_P_K

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #35 dnia: Listopad 04, 2021, 07:47:35 am »

Są szanse na aDNA z płd.-wsch. peryferii kultury przeworskiej. Na razie dwa szkielety, ale może znajdą więcej. Z eponimicznego cmentarzyska w Gaci k. Przeworska - powinni się przyłożyć i zrobić genomy referencyjne, jakieś 30x :)
« Ostatnia zmiana: Listopad 04, 2021, 07:52:28 am wysłana przez S_u_P_K »
Zapisane

Radek

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #36 dnia: Listopad 04, 2021, 07:48:15 am »

Ta linia ma datę 1700 BP (100 AD - przełom I i II w. n.e. - u Arzy to szacowany wiek mutacji po jakiejś kalibracji daty). Po doliczeniu 20% uzyskuje się najwyżej (licząc od r. 1950) początek I w. p.n.e. Okres lateński jest bodajże wcześniejszy (zwłaszcza popularność inhumacji w Czechach).

Widzialem rowniez wieksze roznice. Jak dobrze pamietam, wiek linii Y-DNA probki Sunghir6 byl poczatkowo datowany na 400ybp.

Moze to byc rowniez jednak probka sredniowieczna ;) Z przeciekow wiem, ze wsrod probek wielkomorawskich beda linie ponizej R-L1029.
Zapisane

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #37 dnia: Listopad 04, 2021, 07:50:12 am »

Radku, po pierwsze, nie istnieją żadne podstawy, by zakładać, że wszyscy wcześni Słowianie wyglądali genetycznie jak Av2, a po drugie tym, co się zmieniło, był obrządek pogrzebowy.   
Zapisane

S_u_P_K

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #38 dnia: Listopad 04, 2021, 07:51:30 am »

Dziwne byłoby, gdyby w próbkach z VIII-X w. n.e. nie było mutacji poniżej węzła L1029.
Zapisane

Radek

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #39 dnia: Listopad 04, 2021, 07:52:32 am »

Dziwne byłoby, gdyby w próbkach z VIII-X w. n.e. nie było mutacji poniżej węzła L1029.

Dokladnie. Wiec zaczekajmy z fanfarami ;)
Zapisane

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #40 dnia: Listopad 04, 2021, 07:54:58 am »

No ale średniowieczny Morawianin z typowo słowiańskim igrekiem i skandynawskim profilem autosomalnym były raczej kuriozum.
Zapisane

S_u_P_K

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #41 dnia: Listopad 04, 2021, 07:56:00 am »

Ja próbkę I13780 uważam za nieco podejrzaną z pktu widzenia chronologii. Głównie ze względu na tę późną mutację.
Zapisane

Radek

  • Gość
Odp: Lateńskie L1029
« Odpowiedź #42 dnia: Listopad 04, 2021, 07:56:30 am »

Radku, po pierwsze, nie istnieją żadne podstawy, by zakładać, że wszyscy wcześni Słowianie wyglądali genetycznie jak Av2, a po drugie tym, co się zmieniło, był obrządek pogrzebowy.

A czy ja pisze, ze tak wygladali wszyscy wczesni Slowianie? Mogli np. wygladac rowniez podobnie do tych z Krakauer Berg, Pohansko czy slowianskich "wikingow", czyli zroznicowanie od Litwinow po wschodnich Czechow.
Zapisane

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #43 dnia: Listopad 04, 2021, 07:58:10 am »

No to mamy takie próbki sprzed średniowiecza.
Zapisane

ambroziak

  • Global Moderator
  • Hero Member
  • *****
  • Wiadomości: 28592
    • Zobacz profil
Odp: Lateńskie L1029
« Odpowiedź #44 dnia: Listopad 04, 2021, 07:59:55 am »

Skromny, ale ta próbka, jak twierdził Dawid, ma pochodzić z szerszego kontekstu lateńskiego z dominującym skandynawskim wzorem autosomalnym.
Zapisane
Strony: 1 2 [3] 4 5 ... 28